Review



human snai1 cdna  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc human snai1 cdna
    (A–D) 344SQ_miR-34a cells and 344SQ_vector cells were cultured in the presence or absence of doxycycline (Dox). (A) Q-PCR analysis of miR-34a levels. (B) Cell numbers in monolayer. Migrating (C) and invading (D) cells in Boyden chambers were photographed and counted. Scale bars: 100 μm. (E) Primary tumor weight and total lung metastases from flank tumors in syngeneic mice (mean ± SD, n = 5). P values were determined by 2-tailed Student’s t test. (F) MDA-MB-231 cells were transiently transfected with a random sequence miR precursor molecule control or with pre–miR-34a precursor. Shown are Q-PCR analysis of miR-34a levels, expressed relative to control transfectants (set at 1.0), and migration and invasion assays in Boyden chambers. (G and H) Q-PCR analysis of epithelial (Cdh1 and Scrib) and mesenchymal (Cdh2 and Vim) markers and their transcriptional regulators (Zeb1, Zeb2, <t>Snai1,</t> Snai2, and Twist1) in 344SQ_vector and 344SQ_miR-34a cells (G) and in MDA-MB-231 cells transiently transfected with pre-miR control or pre–miR-34a precursor (H). Results are expressed relative to control transfectants (set at 1.0). Data are mean ± SD (n = 3). *P < 0.01. (I) Kaplan-Meier analysis of 3 independent cohorts of lung cancer patients (33–35), comparing the differences in risk between tumors with high (>0) or low (<0) scores (36), reflecting the presence or absence, respectively, of overlap with the murine miR-34a signature. P values from log-rank (differences between arms) and univariate Cox (gene signature score as a continuous variable) tests are shown.
    Human Snai1 Cdna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+snai1+cdna/pmc03428095-430-0-12?v=Addgene+inc
    Average 93 stars, based on 23 article reviews
    human snai1 cdna - by Bioz Stars, 2026-07
    93/100 stars

    Images

    1) Product Images from "ZEB1 drives prometastatic actin cytoskeletal remodeling by downregulating miR-34a expression"

    Article Title: ZEB1 drives prometastatic actin cytoskeletal remodeling by downregulating miR-34a expression

    Journal: The Journal of Clinical Investigation

    doi: 10.1172/JCI63608

    (A–D) 344SQ_miR-34a cells and 344SQ_vector cells were cultured in the presence or absence of doxycycline (Dox). (A) Q-PCR analysis of miR-34a levels. (B) Cell numbers in monolayer. Migrating (C) and invading (D) cells in Boyden chambers were photographed and counted. Scale bars: 100 μm. (E) Primary tumor weight and total lung metastases from flank tumors in syngeneic mice (mean ± SD, n = 5). P values were determined by 2-tailed Student’s t test. (F) MDA-MB-231 cells were transiently transfected with a random sequence miR precursor molecule control or with pre–miR-34a precursor. Shown are Q-PCR analysis of miR-34a levels, expressed relative to control transfectants (set at 1.0), and migration and invasion assays in Boyden chambers. (G and H) Q-PCR analysis of epithelial (Cdh1 and Scrib) and mesenchymal (Cdh2 and Vim) markers and their transcriptional regulators (Zeb1, Zeb2, Snai1, Snai2, and Twist1) in 344SQ_vector and 344SQ_miR-34a cells (G) and in MDA-MB-231 cells transiently transfected with pre-miR control or pre–miR-34a precursor (H). Results are expressed relative to control transfectants (set at 1.0). Data are mean ± SD (n = 3). *P < 0.01. (I) Kaplan-Meier analysis of 3 independent cohorts of lung cancer patients (33–35), comparing the differences in risk between tumors with high (>0) or low (<0) scores (36), reflecting the presence or absence, respectively, of overlap with the murine miR-34a signature. P values from log-rank (differences between arms) and univariate Cox (gene signature score as a continuous variable) tests are shown.
    Figure Legend Snippet: (A–D) 344SQ_miR-34a cells and 344SQ_vector cells were cultured in the presence or absence of doxycycline (Dox). (A) Q-PCR analysis of miR-34a levels. (B) Cell numbers in monolayer. Migrating (C) and invading (D) cells in Boyden chambers were photographed and counted. Scale bars: 100 μm. (E) Primary tumor weight and total lung metastases from flank tumors in syngeneic mice (mean ± SD, n = 5). P values were determined by 2-tailed Student’s t test. (F) MDA-MB-231 cells were transiently transfected with a random sequence miR precursor molecule control or with pre–miR-34a precursor. Shown are Q-PCR analysis of miR-34a levels, expressed relative to control transfectants (set at 1.0), and migration and invasion assays in Boyden chambers. (G and H) Q-PCR analysis of epithelial (Cdh1 and Scrib) and mesenchymal (Cdh2 and Vim) markers and their transcriptional regulators (Zeb1, Zeb2, Snai1, Snai2, and Twist1) in 344SQ_vector and 344SQ_miR-34a cells (G) and in MDA-MB-231 cells transiently transfected with pre-miR control or pre–miR-34a precursor (H). Results are expressed relative to control transfectants (set at 1.0). Data are mean ± SD (n = 3). *P < 0.01. (I) Kaplan-Meier analysis of 3 independent cohorts of lung cancer patients (33–35), comparing the differences in risk between tumors with high (>0) or low (<0) scores (36), reflecting the presence or absence, respectively, of overlap with the murine miR-34a signature. P values from log-rank (differences between arms) and univariate Cox (gene signature score as a continuous variable) tests are shown.

    Techniques Used: Plasmid Preparation, Cell Culture, Transfection, Sequencing, Control, Migration

    (A–D) miR-34a repressed TGF-β–induced invasion in 3D Matrigel cultures. 344SQ_vector cells formed polarized epithelial spheres (A) that became hyperproliferative and invasive in the presence of TGF-β (B). 344SQ_miR-34a cells formed polarized epithelial spheres (C) that did not become invasive in the presence of TGF-β (D). Shown are light (left) and fluorescent (right) microscopic images of structures formed after 10 days in Matrigel containing doxycycline in the presence or absence of TGF-β (10 ng/ml). Blue, Topro-3; red, anti–α6 integrin; green, anti–ZO-1. Scale bars: 200 μm (light); 50 μm (fluorescent). (E) miR-34a did not abrogate TGF-β–induced EMT. Q-PCR analysis of epithelial markers (Cdh1, Scrib, and Crb3) and mesenchymal markers (Cdh2 and Vim) and their transcriptional regulators (Zeb1, Zeb2, Snai1, and Snai2) in 344SQ_vector and 344SQ_miR-34a cells after 10 days in Matrigel cultures containing doxycycline in the presence or absence of TGF-β. Results are expressed relative to empty vector transfectants treated without TGF-β (set at 1.0). Data are mean ± SD (n = 3).
    Figure Legend Snippet: (A–D) miR-34a repressed TGF-β–induced invasion in 3D Matrigel cultures. 344SQ_vector cells formed polarized epithelial spheres (A) that became hyperproliferative and invasive in the presence of TGF-β (B). 344SQ_miR-34a cells formed polarized epithelial spheres (C) that did not become invasive in the presence of TGF-β (D). Shown are light (left) and fluorescent (right) microscopic images of structures formed after 10 days in Matrigel containing doxycycline in the presence or absence of TGF-β (10 ng/ml). Blue, Topro-3; red, anti–α6 integrin; green, anti–ZO-1. Scale bars: 200 μm (light); 50 μm (fluorescent). (E) miR-34a did not abrogate TGF-β–induced EMT. Q-PCR analysis of epithelial markers (Cdh1, Scrib, and Crb3) and mesenchymal markers (Cdh2 and Vim) and their transcriptional regulators (Zeb1, Zeb2, Snai1, and Snai2) in 344SQ_vector and 344SQ_miR-34a cells after 10 days in Matrigel cultures containing doxycycline in the presence or absence of TGF-β. Results are expressed relative to empty vector transfectants treated without TGF-β (set at 1.0). Data are mean ± SD (n = 3).

    Techniques Used: Plasmid Preparation



    Similar Products

    90
    Sino Biological snail sino biol hg16844 ut overexpression vectors
    Snail Sino Biol Hg16844 Ut Overexpression Vectors, supplied by Sino Biological, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+snai1+cdna/pm33313663-50-24-25?v=Sino+Biological
    Average 90 stars, based on 1 article reviews
    snail sino biol hg16844 ut overexpression vectors - by Bioz Stars, 2026-07
    90/100 stars
      Buy from Supplier

    90
    Genechem pcdna 3.1 vector full-length human snai1 cdna
    Pcdna 3.1 Vector Full Length Human Snai1 Cdna, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+snai1+cdna/pm32519176-68-34-41?v=Genechem
    Average 90 stars, based on 1 article reviews
    pcdna 3.1 vector full-length human snai1 cdna - by Bioz Stars, 2026-07
    90/100 stars
      Buy from Supplier

    90
    OriGene snail cdna
    Snail Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+snai1+cdna/10__1158_slash_0008___5472__can___19___0442-68-16-21?v=OriGene
    Average 90 stars, based on 1 article reviews
    snail cdna - by Bioz Stars, 2026-07
    90/100 stars
      Buy from Supplier

    90
    OriGene nm 005985 human cdna
    Nm 005985 Human Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+snai1+cdna/pmc05705820-406-3-9?v=OriGene
    Average 90 stars, based on 1 article reviews
    nm 005985 human cdna - by Bioz Stars, 2026-07
    90/100 stars
      Buy from Supplier

    90
    OriGene d e rev ttcctctgtgcgccgctctctcccaggacaggcac 534 snai1 nm 005985 human cdna
    D E Rev Ttcctctgtgcgccgctctctcccaggacaggcac 534 Snai1 Nm 005985 Human Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+snai1+cdna/10__1128_slash_mcb__00328___17-165-127-137?v=OriGene
    Average 90 stars, based on 1 article reviews
    d e rev ttcctctgtgcgccgctctctcccaggacaggcac 534 snai1 nm 005985 human cdna - by Bioz Stars, 2026-07
    90/100 stars
      Buy from Supplier

    90
    OriGene snail cdna plasmids
    <t>MiR-137</t> and miR-34a modulate EMT, invasion and sphere-forming ability of OC cells through targeting Snail. MiR-137 or miR-34a inhibitor or Neg inhibitor was co-transfected into SKOV-3 cells, together with (or without) Snail siRNA. MiR-137 or miR-34a mimic or Neg mimic was co-transfected into ES-2 cells, together with (or without) Snail <t>cDNA</t> vector lacking the 3′-UTR region. Cell invasion assay ( a ), sphere formation assay ( b ) and Western blotting analysis of indicated proteins ( c ) in OC cells treated as described above were performed. ** P < 0.01
    Snail Cdna Plasmids, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+snai1+cdna/pmc05011787-23-18-21?v=OriGene
    Average 90 stars, based on 1 article reviews
    snail cdna plasmids - by Bioz Stars, 2026-07
    90/100 stars
      Buy from Supplier

    93
    Addgene inc human snai1 cdna
    (A–D) 344SQ_miR-34a cells and 344SQ_vector cells were cultured in the presence or absence of doxycycline (Dox). (A) Q-PCR analysis of miR-34a levels. (B) Cell numbers in monolayer. Migrating (C) and invading (D) cells in Boyden chambers were photographed and counted. Scale bars: 100 μm. (E) Primary tumor weight and total lung metastases from flank tumors in syngeneic mice (mean ± SD, n = 5). P values were determined by 2-tailed Student’s t test. (F) MDA-MB-231 cells were transiently transfected with a random sequence miR precursor molecule control or with pre–miR-34a precursor. Shown are Q-PCR analysis of miR-34a levels, expressed relative to control transfectants (set at 1.0), and migration and invasion assays in Boyden chambers. (G and H) Q-PCR analysis of epithelial (Cdh1 and Scrib) and mesenchymal (Cdh2 and Vim) markers and their transcriptional regulators (Zeb1, Zeb2, <t>Snai1,</t> Snai2, and Twist1) in 344SQ_vector and 344SQ_miR-34a cells (G) and in MDA-MB-231 cells transiently transfected with pre-miR control or pre–miR-34a precursor (H). Results are expressed relative to control transfectants (set at 1.0). Data are mean ± SD (n = 3). *P < 0.01. (I) Kaplan-Meier analysis of 3 independent cohorts of lung cancer patients (33–35), comparing the differences in risk between tumors with high (>0) or low (<0) scores (36), reflecting the presence or absence, respectively, of overlap with the murine miR-34a signature. P values from log-rank (differences between arms) and univariate Cox (gene signature score as a continuous variable) tests are shown.
    Human Snai1 Cdna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+snai1+cdna/pmc03428095-430-0-12?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    human snai1 cdna - by Bioz Stars, 2026-07
    93/100 stars
      Buy from Supplier

    Image Search Results


    MiR-137 and miR-34a modulate EMT, invasion and sphere-forming ability of OC cells through targeting Snail. MiR-137 or miR-34a inhibitor or Neg inhibitor was co-transfected into SKOV-3 cells, together with (or without) Snail siRNA. MiR-137 or miR-34a mimic or Neg mimic was co-transfected into ES-2 cells, together with (or without) Snail cDNA vector lacking the 3′-UTR region. Cell invasion assay ( a ), sphere formation assay ( b ) and Western blotting analysis of indicated proteins ( c ) in OC cells treated as described above were performed. ** P < 0.01

    Journal: Journal of Experimental & Clinical Cancer Research : CR

    Article Title: MiR-137 and miR-34a directly target Snail and inhibit EMT, invasion and sphere-forming ability of ovarian cancer cells

    doi: 10.1186/s13046-016-0415-y

    Figure Lengend Snippet: MiR-137 and miR-34a modulate EMT, invasion and sphere-forming ability of OC cells through targeting Snail. MiR-137 or miR-34a inhibitor or Neg inhibitor was co-transfected into SKOV-3 cells, together with (or without) Snail siRNA. MiR-137 or miR-34a mimic or Neg mimic was co-transfected into ES-2 cells, together with (or without) Snail cDNA vector lacking the 3′-UTR region. Cell invasion assay ( a ), sphere formation assay ( b ) and Western blotting analysis of indicated proteins ( c ) in OC cells treated as described above were performed. ** P < 0.01

    Article Snippet: MiRNA mimic and miRNA inhibitor for miR-137 or miR-34a (30 nM, Ambion), Snail siRNA (5 nM, Ambion) and Snail cDNA plasmids (OriGene) were transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol.

    Techniques: Transfection, Plasmid Preparation, Invasion Assay, Tube Formation Assay, Western Blot

    (A–D) 344SQ_miR-34a cells and 344SQ_vector cells were cultured in the presence or absence of doxycycline (Dox). (A) Q-PCR analysis of miR-34a levels. (B) Cell numbers in monolayer. Migrating (C) and invading (D) cells in Boyden chambers were photographed and counted. Scale bars: 100 μm. (E) Primary tumor weight and total lung metastases from flank tumors in syngeneic mice (mean ± SD, n = 5). P values were determined by 2-tailed Student’s t test. (F) MDA-MB-231 cells were transiently transfected with a random sequence miR precursor molecule control or with pre–miR-34a precursor. Shown are Q-PCR analysis of miR-34a levels, expressed relative to control transfectants (set at 1.0), and migration and invasion assays in Boyden chambers. (G and H) Q-PCR analysis of epithelial (Cdh1 and Scrib) and mesenchymal (Cdh2 and Vim) markers and their transcriptional regulators (Zeb1, Zeb2, Snai1, Snai2, and Twist1) in 344SQ_vector and 344SQ_miR-34a cells (G) and in MDA-MB-231 cells transiently transfected with pre-miR control or pre–miR-34a precursor (H). Results are expressed relative to control transfectants (set at 1.0). Data are mean ± SD (n = 3). *P < 0.01. (I) Kaplan-Meier analysis of 3 independent cohorts of lung cancer patients (33–35), comparing the differences in risk between tumors with high (>0) or low (<0) scores (36), reflecting the presence or absence, respectively, of overlap with the murine miR-34a signature. P values from log-rank (differences between arms) and univariate Cox (gene signature score as a continuous variable) tests are shown.

    Journal: The Journal of Clinical Investigation

    Article Title: ZEB1 drives prometastatic actin cytoskeletal remodeling by downregulating miR-34a expression

    doi: 10.1172/JCI63608

    Figure Lengend Snippet: (A–D) 344SQ_miR-34a cells and 344SQ_vector cells were cultured in the presence or absence of doxycycline (Dox). (A) Q-PCR analysis of miR-34a levels. (B) Cell numbers in monolayer. Migrating (C) and invading (D) cells in Boyden chambers were photographed and counted. Scale bars: 100 μm. (E) Primary tumor weight and total lung metastases from flank tumors in syngeneic mice (mean ± SD, n = 5). P values were determined by 2-tailed Student’s t test. (F) MDA-MB-231 cells were transiently transfected with a random sequence miR precursor molecule control or with pre–miR-34a precursor. Shown are Q-PCR analysis of miR-34a levels, expressed relative to control transfectants (set at 1.0), and migration and invasion assays in Boyden chambers. (G and H) Q-PCR analysis of epithelial (Cdh1 and Scrib) and mesenchymal (Cdh2 and Vim) markers and their transcriptional regulators (Zeb1, Zeb2, Snai1, Snai2, and Twist1) in 344SQ_vector and 344SQ_miR-34a cells (G) and in MDA-MB-231 cells transiently transfected with pre-miR control or pre–miR-34a precursor (H). Results are expressed relative to control transfectants (set at 1.0). Data are mean ± SD (n = 3). *P < 0.01. (I) Kaplan-Meier analysis of 3 independent cohorts of lung cancer patients (33–35), comparing the differences in risk between tumors with high (>0) or low (<0) scores (36), reflecting the presence or absence, respectively, of overlap with the murine miR-34a signature. P values from log-rank (differences between arms) and univariate Cox (gene signature score as a continuous variable) tests are shown.

    Article Snippet: Human SNAI1 cDNA (catalog no. 16218), murine Twist1 cDNA (catalog no. 1783; Addgene), murine Arhgap1 cDNA, and murine Arhgap1 shRNA (Origene) were purchased.

    Techniques: Plasmid Preparation, Cell Culture, Transfection, Sequencing, Control, Migration

    (A–D) miR-34a repressed TGF-β–induced invasion in 3D Matrigel cultures. 344SQ_vector cells formed polarized epithelial spheres (A) that became hyperproliferative and invasive in the presence of TGF-β (B). 344SQ_miR-34a cells formed polarized epithelial spheres (C) that did not become invasive in the presence of TGF-β (D). Shown are light (left) and fluorescent (right) microscopic images of structures formed after 10 days in Matrigel containing doxycycline in the presence or absence of TGF-β (10 ng/ml). Blue, Topro-3; red, anti–α6 integrin; green, anti–ZO-1. Scale bars: 200 μm (light); 50 μm (fluorescent). (E) miR-34a did not abrogate TGF-β–induced EMT. Q-PCR analysis of epithelial markers (Cdh1, Scrib, and Crb3) and mesenchymal markers (Cdh2 and Vim) and their transcriptional regulators (Zeb1, Zeb2, Snai1, and Snai2) in 344SQ_vector and 344SQ_miR-34a cells after 10 days in Matrigel cultures containing doxycycline in the presence or absence of TGF-β. Results are expressed relative to empty vector transfectants treated without TGF-β (set at 1.0). Data are mean ± SD (n = 3).

    Journal: The Journal of Clinical Investigation

    Article Title: ZEB1 drives prometastatic actin cytoskeletal remodeling by downregulating miR-34a expression

    doi: 10.1172/JCI63608

    Figure Lengend Snippet: (A–D) miR-34a repressed TGF-β–induced invasion in 3D Matrigel cultures. 344SQ_vector cells formed polarized epithelial spheres (A) that became hyperproliferative and invasive in the presence of TGF-β (B). 344SQ_miR-34a cells formed polarized epithelial spheres (C) that did not become invasive in the presence of TGF-β (D). Shown are light (left) and fluorescent (right) microscopic images of structures formed after 10 days in Matrigel containing doxycycline in the presence or absence of TGF-β (10 ng/ml). Blue, Topro-3; red, anti–α6 integrin; green, anti–ZO-1. Scale bars: 200 μm (light); 50 μm (fluorescent). (E) miR-34a did not abrogate TGF-β–induced EMT. Q-PCR analysis of epithelial markers (Cdh1, Scrib, and Crb3) and mesenchymal markers (Cdh2 and Vim) and their transcriptional regulators (Zeb1, Zeb2, Snai1, and Snai2) in 344SQ_vector and 344SQ_miR-34a cells after 10 days in Matrigel cultures containing doxycycline in the presence or absence of TGF-β. Results are expressed relative to empty vector transfectants treated without TGF-β (set at 1.0). Data are mean ± SD (n = 3).

    Article Snippet: Human SNAI1 cDNA (catalog no. 16218), murine Twist1 cDNA (catalog no. 1783; Addgene), murine Arhgap1 cDNA, and murine Arhgap1 shRNA (Origene) were purchased.

    Techniques: Plasmid Preparation